An alfred workflow for working with sequence data

June 11, 2015   

I’ve put together a simple alfred workflow with a few utilities for working with sequence data.

Download the latest release of Seq-Utilities

Usage

Generate a random dna sequence 200 base pairs long.

dna1

Generate the complement, reverse complement, RNA, and protein of a DNA sequence

dna2

Open up blast and pre-populate the search field

blast ATGTCCTCGTTCGACCGTCGTATTGAAGCTGCATGTAAA
Alfred  Genetics